Adenine, Thymine, Guanine & Cytosine | Overview & Pairing

9. DNA complementary to pepper mRNA was synthesized using oligo (dT) as a primer for first strandsynthesis. The second strand (synonymous with the mRNA) was then synthesized, and thepopulation of double stranded cDNAs were ligated into a plasmid vector using a procedure thatleaves Pstl sites flanking the cDNA insert (i.e. the terminal Pstl sites for each clone are not part ofthe cDNA). This cDNA library was screened for clones made from the mRNA from the pepper yellowgene. One clone was isolated

Answered: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand | bartleby